Everything below concerns vacuum sealing. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2026-08-01. Numbers and descriptions here follow the published literature rather than marketing material.
A formulation often contains excipients that protect the active ingredient during freezing and drying. Bulking agents provide structure, while lyoprotectants stabilize sensitive molecules. The freezing step can produce ice crystals whose size and distribution affect the drying rate, and cycle design includes freezing, annealing, and drying phases. If the product temperature rises above a critical value, the cake may collapse or lose its porous structure. Successful lyophilization therefore depends on the interaction between formulation, equipment, and cycle design.
Lyophilization is a dehydration process that removes water from a frozen material by sublimation under low pressure. The material is first frozen to convert liquid water into ice. Next, the pressure is reduced below the triple point of water so that ice changes directly into vapor without passing through a liquid phase. This step is called primary drying. The result is a porous solid or cake that retains the original shape of the frozen solution.
After primary drying, secondary drying removes water that remains bound to the material. This stage raises the shelf temperature while maintaining low pressure, which encourages desorption of unfrozen water. Residual moisture can be reduced to a low percentage, improving stability for many products. The process parameters, including freezing rate, shelf temperature, and chamber pressure, influence the final pore structure and reconstitution behavior. Control of these variables helps prevent collapse or meltback during drying.
Misconceptions about lyophilization include the idea that dried products are indefinitely stable or that vacuum sealing eliminates all degradation. Chemical reactions can continue in the solid state, and some proteins lose activity even at low moisture. Another misconception is that any freeze-dryer cycle can be scaled by time alone; heat and mass transfer differ with equipment and load. Open questions remain about predicting long-term stability from short accelerated studies, particularly for amorphous formulations. Real-time stability data remain the standard for shelf-life assignment.
After lyophilization, the dried product is often sealed under vacuum or an inert gas to limit moisture and oxygen exposure. Vials, stoppers, and seals must maintain their barrier throughout shelf life. Storage temperature depends on product sensitivity: some cakes tolerate controlled room temperature, while labile biologics require refrigeration. Humidity is a critical variable because dried cakes are hygroscopic and can absorb water when exposed to air. Handling procedures therefore limit open-vial time and use desiccated environments for sampling.
| Property | Value | Notes |
|---|---|---|
| Common synonyms | Freeze-drying, lyophilisation | Lyophilization is the American spelling; lyophilisation is British |
| Primary drying mechanism | Sublimation of ice | Occurs under vacuum below the triple point |
| Typical chamber pressure | 0.05-0.5 mbar | Range depends on product and equipment |
| Typical shelf temperature during freezing | -40 to -20 °C | Lower temperatures may be used for labile products |
| Resulting product form | Porous cake or powder | Appearance depends on formulation and cycle |
The process generally proceeds in three stages: freezing, primary drying, and secondary drying. During freezing, controlled cooling converts water into ice and may also crystallize or vitrify solutes. In primary drying, the pressure is lowered below the triple point, and heat is supplied so ice sublimes directly to vapor. Secondary drying removes water that remains bound to the solid matrix, yielding a low final water content. Product temperature must stay below the collapse or glass transition temperature to maintain structure. Cycle design therefore balances shelf temperature, chamber pressure, and time.
Freeze-drying is used for materials whose activity or structure depends on low temperature and low water content. Examples include certain biologics, diagnostic reagents, starter cultures, coffee, and porous inorganic precursors. The dried product forms a cake whose porosity aids rapid wetting and dissolution. Main drawbacks are high energy use, long cycle times, and sensitivity to formulation and equipment variation. Questions remain about how freezing rates and ice morphology affect batch uniformity, especially when moving from laboratory to production scale.
Lyophilization, also called freeze-drying, is a dehydration process in which a solvent, usually water, is frozen and then removed by sublimation under reduced pressure. The method preserves heat-sensitive materials that would degrade in conventional drying. Large-scale use grew during the mid-twentieth century for blood plasma and antibiotics, and it later expanded to vaccines, enzymes, foods, and advanced materials. The process produces a dry, porous solid that usually reconstitutes rapidly. It is distinct from simple evaporation because the solvent bypasses the liquid phase during primary removal.
Lyophilized products are typically hygroscopic and require protection from moisture during storage. Manufacturers seal them in glass vials, often under vacuum or an inert gas such as nitrogen. The container closure system, including the stopper and crimp seal, must prevent water vapor ingress. Storage temperature varies from controlled room temperature to refrigerated or frozen conditions, depending on the formulation. Humidity-controlled environments are essential because even brief exposure to ambient air can degrade the product.
Stability of a lyophilized product depends on its glass transition temperature, the temperature at which the amorphous cake transitions from a glassy to a rubbery state. Storage below this temperature minimizes molecular mobility and slows chemical degradation. If the storage temperature exceeds the glass transition temperature, the cake may collapse, shrink, or become sticky. Accelerated stability studies at elevated temperatures and humidity help predict shelf life, but they do not always reflect real-time behavior. Residual moisture content also plays a critical role in long-term stability.
Homosexual acts are prohibited by law in Ghana. According to a 2013 survey by the Pew Research Center, 96% of Ghanaians believe that homosexuality should not be accepted by society. In 2026 further laws were introduced creating a duty to report homosexual acts and to criminalise "supporters" of LGBTQ+ people. Sometimes elderly women in Ghana are accused of witchcraft, particularly in rural Ghana. Issues of witchcraft mainly remain as speculations based on superstitions within families. In some parts of northern Ghana witch camps exist. These are said to house a total of around 1,000 people accused of and ostracised for witchcraft. The Ghanaian government announced that it intended to close the camps. Over a decade later, in 2023, the Anti-Witchcraft bill passed in parliament, to address accusations and the social impacts of being accused of being a witch, and the president refused to sign it into law. The legislation was reintroduced in 2025.
The design, production, and distribution of drugs are highly regulated. This includes software systems. For example, in the US, the Food and Drug Administration have regulations in Part 21 of the Code of Federal Regulations. Nash et al. have published a book which provides a comprehensive coverage on the various validation topics of pharmaceutical manufacturing processes. Some companies are taking a risk-based approach to validating their GAMP system if one understands the regulatory requirements very well while the most of others follows the conventional process It is a part of GxP management. The aspects of validation and verification are even more intense and emphasized if an OOS occurs. Very often under this circumstance, a multiplicated sample analysis is required for conducting the OOS investigation in a testing laboratory. Medical devices The FDA (21 CFR) has validation and verification requirements for medical devices, as outlined in ASME V&V 40. Also see guidance: and ISO 13485. Manufacturing process and cleaning validation are compulsory and regulated by the U.S.
Glucose is an energy source in most life forms. For instance, polysaccharides are broken down into their monomers by enzymes (glycogen phosphorylase removes glucose residues from glycogen, a polysaccharide). Disaccharides like lactose or sucrose are cleaved into their two component monosaccharides.
== Treatment == No curative treatment is available for prolidase deficiency at this time, although palliative treatment is possible to some extent. The latter mainly focuses on treating the skin lesions through standard methods and stalling collagen degradation (or boosting prolidase performance, where possible), so as to keep the intracellular dipeptide levels low and give the cells time to resynthesise or absorb what proline they cannot recycle so as to be able to rebuild what collagen does degrade. Patients can be treated orally with ascorbate (a.k.a. vitamin C, a cofactor of prolyl hydroxylase, an enzyme that hydroxylates proline, increasing collagen stability), manganese (a cofactor of prolidase), suppression of collagenase (a collagen degrading enzyme), and local applications of ointments that contain L-glycine and L-proline. The response to the treatment is inconsistent between affected individuals. A therapeutic approach based on enzyme replacement (administering functional prolidase) is under consideration. Due to the weakened immune response in PD cases, it is also of paramount importance to keep any infections under control, often with heavy antibiotics.
At least one more regulated transport process is involved. The stoichiometry of bone mineral basically is that of hydroxyapatite precipitating from phosphate, calcium, and water at a slightly alkaline pH:
Sources: en.wikipedia.org
Cartilage is a resilient and smooth type of connective tissue. Semi-transparent and non-porous, it is usually covered by a tough and fibrous membrane called perichondrium. In tetrapods, it covers and protects the ends of long bones at the joints as articular cartilage, and is a structural component of many body parts including the rib cage, the neck and the bronchial tubes, and the intervertebral discs. In other taxa, such as chondrichthyans and cyclostomes, it constitutes a much greater proportion of the skeleton. It is not as hard and rigid as bone, but it is much stiffer and much less flexible than muscle or tendon. The matrix of cartilage is made up of glycosaminoglycans, proteoglycans, collagen fibers and, sometimes, elastin. It usually grows quicker than bone. Because of its rigidity, cartilage often serves the purpose of holding tubes open in the body. Examples include the rings of the trachea, such as the cricoid cartilage and carina. Cartilage is composed of specialized cells called chondrocytes that produce a large amount of collagenous extracellular matrix, abundant ground substance that is rich in proteoglycan and elastin fibers. Cartilage is classified into three types — elastic cartilage, hyaline cartilage, and fibrocartilage — which differ in their relative amounts of collagen and proteoglycan. As cartilage does not contain blood vessels or nerves, it is insensitive. However, some fibrocartilage such as the meniscus of the knee has partial blood supply. Nutrition is supplied to the chondrocytes by diffusion.
Tumor that can affect bone in several ways. Examples of benign bone tumors include osteoma, osteoid osteoma, osteochondroma, osteoblastoma, enchondroma, giant-cell tumor of bone, and aneurysmal bone cyst.
== Mechanical stress == Wounds under 2 millimeters generally do not scar, but larger wounds generally do scar. In 2011, it was found that mechanical stress can stimulate scarring and that stress shielding can reduce scarring in wounds. In 2021, it was found that using chemicals to manipulate fibroblasts to not sense mechanical stress brought scar-free healing. The scar-free healing also occurred when mechanical stress was blocked in a wound.
Although lemborexant has a longer terminal elimination half-life than suvorexant, it appears to be more rapidly cleared than suvorexant in the earlier phases of elimination. In addition, lemborexant dissociates from the orexin receptors more rapidly than does suvorexant. These differences may allow for comparatively reduced next-day effects such as daytime somnolence with lemborexant.
Sources: en.wikipedia.org
=== Surgery === Corneal transplant surgery may be difficult due to the peripheral thinning of the cornea, even with large and off-center grafts. Therefore, surgery is usually reserved for people that do not tolerate contact lenses. Several different surgical approaches may be taken, and no one approach is currently established as the standard. Examples of surgical procedures used for PMD include: wedge resection, lamellar crescentic resection, penetrating keratoplasty, lamellar keratoplasty, epikeratoplasty and intracorneal segments. Transplantation of the entire thickness of the cornea (penetrating keratoplasty) may be performed if there is enough normal tissue present. However, if there is not enough normal tissue present, then attaching the graft is difficult. New surgical techniques are in evaluation such as Intrastromal lamellar Keratoplasties and Sclerocorneal Intrastromal Lamellar Keratoplasty (SILK), these techniques allow thickening of the inferior peripheral cornea and steepening of the vertical meridien. Due to the thinning of the cornea, people with PMD are poor candidates for procedures such as LASIK and photorefractive keratectomy.
== Clinical features == The disease caused by infection with this parasite is known as rangeliosis. In Brazil it is also known as nambi-uvú (bleeding ears), peste de sangue (bleeding plague) and febre amarela dos cães (yellow fever of dogs).
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
Sources: en.wikipedia.org
Lyophilization removes water by sublimation from a frozen material, while evaporation changes liquid water into vapor. The low-pressure freezing step avoids the liquid phase and can preserve heat-sensitive structures.
Vacuum lowers the pressure below the triple point of water, allowing ice to sublimate directly into vapor. It also helps remove water vapor from the product chamber and shortens primary drying.
Many aqueous solutions and suspensions can be freeze-dried, but some formulations collapse or do not form a stable cake. The process requires careful formulation and cycle development.
No. Freeze-drying removes water but does not reliably kill microorganisms. Sterile lyophilized products are typically prepared aseptically before freezing or are sterilized by a validated method. Microbial control depends on the entire manufacturing process.